BDB - Library Details

Library

Library Name: T7 X7 phage display library (X7)

Library ID:

513

Library Length:

Library Complexity:

Library Titer:

Library From:

Library Randomness:

Library Scheme:

NNM

Library Topology:

Linear

Comments:

A T7 phage library displaying random 7‐mer peptides was constructed using the phage vector T7Select 415 (Merck). Briefly, the template oligonucleotide (5′‐GCCGCAAGCTTTTATCCMNNMNNMNNMNNMNNMNNMNNACCTCCACC TGAATTCGG ATC‐3′) was synthesized to add random amino acid sequences to the C‐terminus of the G10 protein of T7 phage via the triple glycine (GGG) as a linker peptide, and it was amplified by PCR using forward and reverse primers (5′‐GATCCGAATTCAGGTGGAGG‐3′ and 5′‐GCCGC AAGCTTTTATCC‐3′, respectively), which included the restriction enzyme sites for EcoRI and HindIII, respectively. DNA fragments obtained by PCR were digested with EcoRI and HindIII and were ligated into the same restriction sites in the T7Select 415 vector. The in vitro packaging was performed using a T7 packaging extract (Merck) according to the manufacturer's protocol, and the packaged T7 phages were used to infect Escherichia coli BL21 cells and amplified once.

First |

Prev |

513

| Next

| Last