<result><Template><Item><Template_ID>551</Template_ID>
<Template_Name>Haemonchus contortus</Template_Name>
<Template_Type>Cell</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Haemonchus contortus:6289</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>552</Template_ID>
<Template_Name>M. pneumoniae</Template_Name>
<Template_Type>Cell</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Unknown</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>553</Template_ID>
<Template_Name>Leukocyte elastase inhibitor (LEI)</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source></Template_Source>
<Template_Structure></Template_Structure>
<Comments>Leukocyte elastase inhibitor (LEI) also known as serpin B1 which is a cytoplasmic serine protease inhibitor of polymorphonuclear neutrophils. Among other serine proteases, it specifically inhibits neutrophil elastase, PR3 and cathepsin G, all found in neutrophil granules, by a suicide inhibition mechanism.</Comments>
</Item><Item><Template_ID>554</Template_ID>
<Template_Name>Splicing factor 3B subunit 1</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>Q99NB9</Template_Sequence>
<Synonyms>Pre-mRNA-splicing factor SF3b 155 kDa subunit, SF3b155
Spliceosome-associated protein 155, SAP 155</Synonyms>
<Template_Source>Mus musculus (Mouse):10090</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>555</Template_ID>
<Template_Name>Glomerular basement membrane</Template_Name>
<Template_Type>Organ and tissue</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Rattus norvegicus (Rat):10116</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>556</Template_ID>
<Template_Name>Fibroblast growth factor 1, FGF-1</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P05230</Template_Sequence>
<Synonyms>Acidic fibroblast growth factor, aFGF
Endothelial cell growth factor, ECGF
Heparin-binding growth factor 1, HBGF-1</Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure>1AXM, 1DJS, 1DZC, 1DZD, 1E0O, 1EVT, 1HKN, 1JQZ, 1JT3, 1JT4, 1JT5, 1JT7, 1JTC, 1JY0, 1K5U, 1K5V, 1M16, 1NZK, 1P63, 1PZZ, 1Q03, 1Q04, 1QCT, 1RG8, 1RML, 1RY7, 1YTO, 1Z2V, 1Z4S, 2AFG, 2AQZ, 2AXM, 2ERM, 2HW9, 2HWA, 2HWM, 2HZ9, 2K43, 2K4A, 2K8R, 2KI4, 2KI6, 2NTD, 2Q9X, 2RQ9, 3B9U, 3BA4, 3BA5, 3BA7, 3BAD, 3BAG, 3BAH, 3BAO, 3BAQ, 3BAU, 3BAV, 3BB2, 3CQA, 3CRG, 3CRH, 3CRI, 3CU1, 3FGM, 3FJ8, 3FJ9, 3FJA, 3FJB, 3FJC, 3FJD, 3FJE, 3FJF, 3FJH, 3FJI, 3FJJ, 3FJK, 3HOM, 3JUT, 3K1X, 3O3Q, 3OJ2, 3OJM, 3OJV, 3UD7, 3UD8, 3UD9, 3UDA, 4J23, 4Q91, 4Q9G, 4Q9P, 4QAL, 4QBC, 4QBV, 4QC4, 4QO3, 4XKI, 4YOL</Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>557</Template_ID>
<Template_Name>Goat immunoglobulin G</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source> Capra hircus (Goat):9925</Template_Source>
<Template_Structure></Template_Structure>
<Comments>Goat immunoglobulin G (IgG) was purchased from Sigma (St. Louis, MO, USA).</Comments>
</Item><Item><Template_ID>558</Template_ID>
<Template_Name>Pancreatic trypsin inhibitor</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P00974</Template_Sequence>
<Synonyms>Aprotinin, Basic protease inhibitor</Synonyms>
<Template_Source>Bos taurus (Bovine):9913</Template_Source>
<Template_Structure>1AAL, 1B0C, 1BHC, 1BPI, 1BPT, 1BRB, 1BTH, 1BTI, 1BZ5, 1BZX, 1CBW, 1CO7, 1D0D, 1EAW, 1EJM, 1F5R, 1F7Z, 1FAK, 1FAN, 1FY8, 1G6X, 1JV8, 1JV9, 1K09, 1K6U, 1LD5, 1LD6, 1MTN, 1NAG, 1OA5, 1OA6, 1P2I, 1P2J, 1P2K, 1P2M, 1P2N, 1P2O, 1P2Q, 1PIT, 1QLQ, 1T7C, 1T8L, 1T8M, 1T8N, 1T8O, 1TPA, 1UUA, 1UUB, 1YKT, 1YLC, 1YLD, 2FI3, 2FI4, 2FI5, 2FTL, 2FTM, 2HEX, 2IJO, 2KAI, 2PTC, 2R9P, 2RA3, 2TGP, 2TPI, 2ZJX, 2ZVX, 3BTD, 3BTE, 3BTF, 3BTG, 3BTH, 3BTK, 3BTM, 3BTQ, 3BTW, 3FP6, 3FP7, 3FP8, 3GYM, 3LDI, 3LDJ, 3LDM, 3OTJ, 3P92, 3P95, 3TGI, 3TGJ, 3TGK, 3TPI, 3U1J, 3WNY, 4BNR, 4DG4, 4PTI, 4TPI, 4WWY, 4WXV, 4Y0Y, 4Y0Z,4Y10, 4Y11, 5JB4, 5JB5, 5JB6, 5JB7, 5PTI, 5XX2, 5XX3, 5XX4, 5XX5, 5XX6, 5XX7, 5XX8, 6F1F, 6PTI, 7PTI, 8PTI, 9PTI</Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>559</Template_ID>
<Template_Name>GSFLSPEHQRVQ</Template_Name>
<Template_Type></Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>None</Template_Source>
<Template_Structure></Template_Structure>
<Comments>Peptide GSFLSPEHQRVQ was synthsized with Ser modified with n-octanoic acid. It mapped to the N-terminus of the active human ghrelin.</Comments>
</Item><Item><Template_ID>560</Template_ID>
<Template_Name>N-terminal appetite-regulating hormone[24-51]</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>Q9UBU3</Template_Sequence>
<Synonyms>Growth hormone secretagogue
Growth hormone-releasing peptide
Motilin-related peptide
Protein M46</Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>561</Template_ID>
<Template_Name>C-terminal appetite-regulating hormone[24-51]Growth hormone secretagogue
Growth hormone-releasing peptide
Motilin-related peptide
Protein M46</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>Q9UBU3</Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>562</Template_ID>
<Template_Name>Histamine H4 receptor, H4R</Template_Name>
<Template_Type>Protein&gt;Receptor</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Unknown</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>563</Template_ID>
<Template_Name>Human immunoglobulin M (IgM)</Template_Name>
<Template_Type>Protein&gt;Polyclonal antibody</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>564</Template_ID>
<Template_Name>Vascular endothelial growth factor C and D</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P97953, P97946</Template_Sequence>
<Synonyms>Alternative name(s) for VEGF-C:
Flt4 ligand
Flt4-L
Vascular endothelial growth factor-related protein
VRP
Alternative name(s) for VEGF-D:
c-Fos-induced growth factor
FIGF</Synonyms>
<Template_Source>Mus musculus (Mouse):10090</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>569</Template_ID>
<Template_Name>Imidacloprid</Template_Name>
<Template_Type>Organic molecules or materials</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>None</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>567</Template_ID>
<Template_Name>α2,6-sialyllactose, 6'-SL</Template_Name>
<Template_Type>Organic molecules or materials</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Unknow</Template_Source>
<Template_Structure></Template_Structure>
<Comments>6'-SL (Cat# 35890-39-2) was purchased from Dextra Laboratories (Reading, England, UK).</Comments>
</Item><Item><Template_ID>568</Template_ID>
<Template_Name>σA protein</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Duck reovirus</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>565</Template_ID>
<Template_Name>Low-density lipoprotein</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>566</Template_ID>
<Template_Name>D-antigen</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P03301</Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Poliovirus type 1 (strain Sabin):12082</Template_Source>
<Template_Structure></Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>570</Template_ID>
<Template_Name>Electronegative low-density lipoprotein, LDL (−)</Template_Name>
<Template_Type>Protein&gt;Enzyme</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure></Template_Structure>
<Comments>The electronegative low-density lipoprotein, LDL (−), is an endogenously modified LDL subfraction with cytotoxic and proinflammatory actions on endothelial cells, monocytes, and macrophages contributing to the progression of atherosclerosis.</Comments>
</Item><Item><Template_ID>571</Template_ID>
<Template_Name>Interleukin-13, IL-13</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P35225</Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Homo sapiens (Human):9606</Template_Source>
<Template_Structure>1GA3, 1IJZ, 1IK0, 3BPO, 3G6D, 3L5W, 3L5X, 3LB6, 4I77, 4PS4, 5E4E, 5L6Y</Template_Structure>
<Comments></Comments>
</Item><Item><Template_ID>572</Template_ID>
<Template_Name>Anti-human IgE mAbs</Template_Name>
<Template_Type>Protein&gt;Monoclonal antibody</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Unknow</Template_Source>
<Template_Structure></Template_Structure>
<Comments>Plates coated with anti-human IgE mAbs (NeoBioscience) were prepared by NeoBioscience.</Comments>
</Item><Item><Template_ID>573</Template_ID>
<Template_Name>Fibronectin-binding protein A</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P14738[189-505]</Template_Sequence>
<Synonyms>FnbpA</Synonyms>
<Template_Source>Staphylococcus aureus:93061</Template_Source>
<Template_Structure>4B5Z</Template_Structure>
<Comments>The gene encoding of the FnBPA‐A protein was amplified from the genomic DNA of S. aureus strain WWGSP‐30 by PCR using specific primers (F: 5′‐CGCGGATCCGTGAAAAACAATCTTAGGTACGGC‐3′,R:5′‐CCGCTCGAGTTAAGCTGTGTGGTAATCAATGTCAAG‐3', underlined for BamH I and Xho I restriction sites).</Comments>
</Item><Item><Template_ID>574</Template_ID>
<Template_Name>Epstein-barr virus (EBV)</Template_Name>
<Template_Type>Virus</Template_Type>
<Template_Sequence></Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Unknow</Template_Source>
<Template_Structure></Template_Structure>
<Comments>MS CSF IgG have significantly higher bindings to EBNA1 epitope than to EBNA2 epitope, whereas EBNA1 and EBNA2 did not significantly differ in binding to IC CSF IgG. Further, the EBNA1 epitope was recognized by OCBs from multiple MS CSF as shown in blotting assays with samples separated by isoelectric focusing. The EBNA1 epitope is reactive to MS intrathecal antibodies corresponding to oligoclonal bands. This reinforces the potential role of EBV in the etiology of MS. EBV sequences used for EBNA1 were UniProt P03211 (Epstein-Barr nuclear antigen 1, Epstein-Barr virus (strain B95–8) (HHV-4) (Human herpesvirus 4)), and for EBNA2 were UniProt P12978 (Epstein-Barr nuclear antigen 2, Epstein-Barr virus (strain B95–8) (HHV-4) (Human herpesvirus 4).</Comments>
</Item><Item><Template_ID>575</Template_ID>
<Template_Name>F1 capsule antigen</Template_Name>
<Template_Type>Protein&gt;Others</Template_Type>
<Template_Sequence>P26948</Template_Sequence>
<Synonyms></Synonyms>
<Template_Source>Yersinia pestis:632</Template_Source>
<Template_Structure>1P5U, 1P5V, 1Z9S, 3DOS, 3DPB, 3DSN, 4AYF, 4AZ8, 4B0M</Template_Structure>
<Comments></Comments>
</Item></Template></result>