301 X16 mRNA display library 16 Nobuhide Doi Completely random NNS Linear The 16-mer random DNA library was amplified from G4SG4S(NNS)16FLAGA6r by PCR using priSP6OGf and priFLAGA6r primers. 302 X(2)-F-X(3)-W-X(2)-L-X(2) mRNA display library 12 Nobuhide Doi Semi-random NNS Linear The 12-mer random DNA library was amplified from X12(FWL)-r using 5' o29-T7-EcoRI and Flag1A-lib primers. 303 X(3)-L-I-X-E-I-X(2)-I-L-X(2)-I-X(3)-L mRNA display library 19 Teruaki Kobayashi Semi-random NNK Linear CA11, a IL-6-binding peptide, was isolated from a random-primed human cDNA library. The X(3)-L-I-X-E-I-X(2)-I-L-X(2)-I-X(3)-L mRNA display library was constructed based on CA11. 304 X16 mRNA display library 16 6.6e20 Hiroshi Yanagawa Completely random NNS Linear Random lib-Fw (a plus chain encoding SP6 promoter, Ω29 sequence, start codon, and a part of G/S linker), and Random lib-Rv (a minus chain encoding a G/S linker, randomized region, FLAG-tag, and A 6 sequence) were used for a wholly random library (library A) containing random 16-aa sequences encoded by (NNS)16 codons. 305 X(2)-V-X-R-X-L-X(4)-D-X-I-X(2) mRNA display library 16 2.0e14 Hiroshi Yanagawa Semi-random NNS Linear Bak lib-Fw (a plus chain encoding T7 promoter, SD sequence, start codon, and a part of G/S linker) and Bak lib-Rv (a minus chain encoding a G/S linker, Bak library, FLAG-tag, and A 6 sequence) were for a partially randomized library (library B), in which 5 residues of the Bak-BH3 sequence were conserved within the 16 residues. 306 X10 mRNA display library 10 Tatsuro Shibui Completely random Linear The template DNA for the library was divided into three pieces and synthesized chemically. These fragments were then connected by annealing, the gaps filled and the DNA amplified with PCR. The constructed DNA templates contain a SP6 promoter and IRES and the coding regions for a random 10-amino acid peptide and FLAG-tag. In order to minimize the appearance of stop codons in the random sequence, a four-nucleotide ratio in each of the first, second, and third letters in codons (PQK)10 was set up (P = T:C:A:G = 15:25:30:30, Q = T:C:A:G = 30:30:30:10, and K = T:C:A:G = 50:0:0:50). 307 [RKEDG]-C-X(10)-C mRNA display library 13 Jack W. Szostak Semi-random NNB Circular 30-nt region (NNB)10 , encoding a random 10-mer peptide, flanked by cysteine codons TGC. The choice of NNB random triplets decreases the number of stop codons in the random portion. The 3' constant region encodes a GSVG spacer and 6 histidines (his(6)-tag). The nine nucleotides downstream of the his 6 -tag are complementary to the 2'-O-Me RNA portion of the cross-linking puromycin-terminated oligonucleotide. They encode the tripeptide HRL, which is followed by a TAG stop codon. 308 YAC-TGZ-(XYZ)18-YAC mRNA display library 21 LIN XiuKun Semi-random Linear The synthesized DNA comprised 21 consecutive random codons, and these random codons were flanked by constant sequences. The 5' primer contained a T7 RNA polymerase promoter, a tobacco mosaic virus (TMV) translation enhancer sequence, and a start codon. The 3' primer included sequences coding for His(6) tag and a complementary sequence for linking with puromycin linker. 309 X20 mRNA display library 20 5.2e12 Rihe Liu Completely random Linear Each sequence in the DNA library contains a T7 RNA polymerase promoter, a TMV translation enhancer sequence, an N-terminal FLAG tag coding sequence, a random cassette encoding 20 consecutive random codons, and a His(6) tag coding sequence. The codon mixtures referred to this had the following nucleotide distributions, as determined by sequencing individual clones. Position 1: 35% A 20% T 27% G 18% C; Position 2: 33% A 29% T 21% G 17% C; Position 3: 22% T 49% G 29% C. 310 M-X(4)-CRATKML mRNA display library 12 1.6e5 David C.H. Yang Semi-random NNS Linear The DNA template contained a T7 promoter, a deletion mutant of 5\'-untranslated region of tobacco mosaic virus 5\'-UTR (ΔTMV) for in vitro transcription and translation, respectively. The reading frame in the DNA template contained four random amino acid residues appended to the N-terminus of a constant sequence. The constant region encoded the amino acid sequence CRATKML, which was derived from the C-terminus of the SNAP-25, and is a known inhibitor of BoNT/A. 311 X27 mRNA display library 27 7.0e13 Richard W. Roberts Completely random Linear The anti-sense DNA oligo 130.2 [5'-AGC GCA AGA GTT ACG CAG CTG (SNN)27 CAT TGT AAT TGT AAA TAG TAA TTG TCC C; S = C or G, N = A, C, G or T] was PCR amplified with primers 47T7FP (5'-GGA TTC TAA TAC GAC TCA CTA TAG GGA CAA TTA CTA TTT ACA ATT AC) and mycRP (5'-AGC GCA AGA GTT ACG CAG CTG) to produce the initial template containing a T7 promoter, a 5'-untranslated region (UTR), an ATG methionine start codon, 27 random amino acids and a constant 30-end that encoded the peptide, QLRNSCA. 312 GPR X(6) mRNA display library 6 Richard W. Roberts Completely random Linear The C-GPR extension library was generated by PCR amplification of the template C-GPR-X6 (5a???2-AGC GCA AGA GTT ACG CAG CTG (SNN)6 CCG TTG ATC GTC CAG CCG TTT GGA CTG AGA CAT TGT AAT TGT AAA TAG TAA TTG TCC C; S = C or G) with primers 47T7FP and mycRP. The purified (QIAquick PCR purification) dsDNA constructs contained a T7 promoter, an untranslated region, and an ORF containing a 3a???2 constant sequence encoding the peptide QLRNSCA. 313 X(5)-C-X(5) mRNA display library 11 3.0e12 Richard W. Roberts Semi-random NNS Linear A synthetic DNA library template sd7 (ACTATTTACAACCACCATG-(NNS)5-TGC-(NNS)5-GGCGGCGACTAAGGACGACGATGACAAGGCGGCGGCGGC) was purified by preparative polyacrylamide gel electrophoresis and amplified by polymerase chain reaction (PCR) with the primers sd2 (GGATTCTAATACGACTCACTATAGGGACAATTACTATTTACAACCACCATG) and sd3 (GCCGCCGCCGCCCTTGTCATCGTCGTCCTTGTAGTC). 314 X15 mRNA display library 15 1.2e11 Michael Famulok Completely random Linear The random region was designed for low stop codon frequency and increased cysteine probability (1 Cys within the random region). The phosphoramidites of A, G, C, and T were dissolved in acetonitrile and then mixed for each codon position as follows: 5, A 19.2%, G 23.4%, C 23.4%, T 34.0%; 6, A 33.2%, G 32.9%, C 13.5%, T 20.4%; and 7, A 0.00%, G 31.0%, C 34.5%, T 34.5%. 315 X10 mRNA display library 10 9.0e12 6.9e13 Richard W. Roberts Completely random NNS Linear Library was constructed by inserting NNS codons at residues 13-22 in the N-myc template. 316 EETI-II mRNA display library (X6) 6 6.4e7 6.0e11 Richard W. Wagner Completely random NNS Linear The double helix mRNA/DNA strand encodes for the tobacco mosaic virus untranslated region and the 28 amino acids of the EETI-II library. The single-stranded poly-A linker is a covalent ~ 100 Å extension of the mRNA strand. The three prime end of the poly-A linker terminates with puromycin, which forms the carboxy-terminus of the peptide encoded by the mRNA. 317 c-myc mRNA display library (X27) 27 2.0e13 Richard W. Wagner Completely random NNS Linear The double helix mRNA/DNA strand encodes for the tobacco mosaic virus untranslated region and the 27 amino acids of the randomized linear peptide library. The single-stranded poly-A linker is a covalent ~ 100 Å extension of the mRNA strand. The three prime end of the poly-A linker terminates with puromycin, which forms the carboxy-terminus of the peptide encoded by the mRNA. 318 [VGAED]-X(14) ribosome display library 15 2.0e13 Volker A. Erdmann Completely random NNS Linear A DNA library encoding FABP, possessing 15 randomized amino acid residues at its N terminus instead of the four natural residues, was generated by introducing a DNA fragment encoding a GNN codon followed by 14 NNS codons into the FABP gene through DNA ligation. The construct used for ribosome display, contains all necessary features; the T7 promoter on the DNA level, and the 5' and 3' stem-loops stabilizing the mRNA against ribonucleases on the RNA level as well as the Shine-Dalgarno sequence for efficient in vitro translation. The 5'-untranslated region of the mRNA is derived from gene 10 of phage T7 and is capable of forming a stable stem-loop structure. The 3' stem-loop comes from a modified lipoprotein terminator (lpp) from Escherichia coli. 319 X12 ribosome display library 12 Xiao-Lian Zhang Completely random NNM Linear A tac promoter sequence and a ribosome-binding site (RBS) were followed by the sequence encoding the protein to be displayed, to effect strong transcription. In addition, at both ends of the mRNA, 5'-stem-loops and 3'-stem-loops were included in the ribosome display system to stabilize mRNA against RNase digestion. 320 X20-[YHND] ribosome display library 21 Sachiko Machida Semi-random NNB Linear This random peptide library was inserted into Cassette 1 and ligated to the other cassettes, followed by prescreening using the FLAG tag to exclude any sequences that did not express the full-length peptide; following prescreening, the library diversity was 1.0e8 per μg DNA. 321 ZXXXZXXZXXXZXX ribosome display library 14 Sachiko Machida Semi-random NNB Linear cDNAs encoding ZXXXZXXZXXXZXX (where Z represents K/R, and X represents any amino acid) were inserted into Cassette 1. 322 X(2)-C-X(10)-C-X(2) ribosome display library 16 Shinya Y. Sawata Semi-random NNY Circular The construct carried a T7 promoter (T7) and a Shine-Dalgarno sequence (SD) necessary for in vitro transcription and translation, respectively. The APL consisted of 14 NNY codons and a pair of TGT codons and was inserted between SfiI restriction sites, followed by the encoding sequences for C-variant RNA (Cv)-associating protein (Cvap) and a protein spacer (Ps). The stop codons were removed from the entire sequence for stalling a ribosome on mRNAs. 323 X10 ribosome display library 10 Yoshihiro Shimizu Completely random NNK Linear A gene for the spacer sequence [protein D (pD), a phage Lambda capsid protein] and the subsequent SecM arrest sequence was sub-cloned into pURE1 vector (post-genome institute) between BamHI and XhoI site. The resultant plasmid was used for the amplification of the library that encodes 10 amino acid random peptide sequences followed by the spacer sequence. Using 10_aa_library primer (5'-GAAGGAGATATACCATATG-(NNK)10-GGATCCGGTGGCGGTTCCG-3'; N is any nucleotide and K is either G or T, respectively) and SecM_25_RD_RT3 primer (5'-AAGCTTCTCGAGCCCGGTGAGGCGT-3'), a library sequence was amplified and purified by gel electrophoresis. The products were used as templates for the second step PCR. Using Universal primer (5'-GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3') and SecM_25_RD_RT3 primer, a library was amplified and purified by gel electrophoresis. The products were used as templates for the ribosome display selection in the PURE system. 324 X9 E. coli bacterial display library 9 4.0e7 4.0e9 Per Klemm Completely random NNB Linear Random peptide library based on oligonucleotides 33 bp in length with BglII overhangs was constructed for display in the type 1 fimbria adhesin FimH. Vector (pLPA30) contained the fimH gene with a BglII linker inserted at codon position 225 and under the transcriptional control of the lac promoter. The inserted double-stranded oligonucleotides consisted of nine random codons flanked by BglII restriction sites (encoding Arg-Ser). Due to the presence of BglII overhangs, various numbers of double-stranded oligonucleotides were inserted in fimH, further adding to the complexity of the library. To express FimH variants as constituents of fimbriae, an auxiliary plasmid (pKKL115), containing all fim genes except fimH, was used for transcomplementation of the fimH-containing plasmid. Expression from the binary plasmid system led to display of chimeric FimH in the context of fully functional fimbriae. 325 X15 E. coli bacterial display library 15 5.0e10 Patrick S. Daugherty Completely random NNS Linear E.coli OmpA was chosen as a display scaffold. To maximize library construction efficiency, asymmetric SfiI restriction sites were introduced into an OmpA expression vector immediately preceding loop 1 and following loop 4. DNA fragments containing the random epitope insertions were synthesized by polymerase chain reaction (PCR), digested with SfiI, ligated into the display vector and transformed into the E.coli strain MC1061, which can be made highly transformation competent and is ara(-), allowing the use of the araBAD promoter for controlled OmpA expression.